| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.044868 |
| Chromosome: | chromosome 16 |
| Location: | 7501145 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687518 | (1 of 1) K03239 - translation initiation factor eIF-2B subunit alpha (EIF2B1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAGGCGAGGTGATGGGGCAGGGCCAAC |
| Internal bar code: | GGTTTCGATCGTGTCACCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 99.664 |
| LEAP-Seq n confirming: | 4746 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTCCAGAGTGAGTGGCT |
| Suggested primer 2: | ACGGCGGAATCATTAACAAG |