Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.044918 |
Chromosome: | chromosome 2 |
Location: | 6129518 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g113400 | PACRG1,PACRG,BUG21 | Parkin Co-Regulated Gene Protein; (1 of 1) PTHR21207:SF2 - PARKIN COREGULATED GENE PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATGTGGACTTGGACCACACCGGCAGCT |
Internal bar code: | TAACGACAGAGCCCCATCCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 600 |
LEAP-Seq percent confirming: | 99.8135 |
LEAP-Seq n confirming: | 2676 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGGGTCCTTCCTAAATGT |
Suggested primer 2: | AAGATGGGCAGGTAGTGGTG |