| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.045046 |
| Chromosome: | chromosome 1 |
| Location: | 2257316 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012350 | (1 of 1) K02331 - DNA polymerase phi [EC:2.7.7.7] (POL5, MYBBP1A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCATCCATACATCTACCCTACACTCA |
| Internal bar code: | CCCCCGTCACCGGGCATCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 263 |
| LEAP-Seq percent confirming: | 86.9491 |
| LEAP-Seq n confirming: | 5583 |
| LEAP-Seq n nonconfirming: | 838 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGGAGTGGTAGAGAGTG |
| Suggested primer 2: | CAGAAGGGCAAGGAGAAGG |