| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045051 |
| Chromosome: | chromosome 12 |
| Location: | 3865882 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515500 | (1 of 1) PF04780 - Protein of unknown function (DUF629) (DUF629) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGGCCCCGCGCTAAGCTATACAAGGGTG |
| Internal bar code: | AATCTTAGTCCCCTCGTCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 146 |
| LEAP-Seq percent confirming: | 94.932 |
| LEAP-Seq n confirming: | 11520 |
| LEAP-Seq n nonconfirming: | 615 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATACGTCAGAAATCCCGC |
| Suggested primer 2: | GGTTTACGGACGTGTGTGTG |