| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045063 |
| Chromosome: | chromosome 7 |
| Location: | 428133 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315200 | NRM3,NRAMP3,RET1 | Related to Ethylene Insensitive Protein 2 (EIN2); (1 of 1) PTHR11706//PTHR11706:SF45 - MANGANESE TRANSPORTER // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCAACCGTGCCGCAAACCATGGCCCCCC |
| Internal bar code: | CGTGGCAAGTGTTGCTGGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 446 |
| LEAP-Seq percent confirming: | 77.6185 |
| LEAP-Seq n confirming: | 704 |
| LEAP-Seq n nonconfirming: | 203 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAGGCAAGCCGTTTACTC |
| Suggested primer 2: | CAGATGCAGCTGTGTGTGTG |