| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.045068 |
| Chromosome: | chromosome 16 |
| Location: | 1018916 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649150 | (1 of 1) PF13414//PF13920 - TPR repeat (TPR_11) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGCACGCCGCGCTCTGGGCTTTGAAGC |
| Internal bar code: | TCAAATAGAATCTATTAATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 93.2849 |
| LEAP-Seq n confirming: | 1542 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCGGACTGGATGGATAGT |
| Suggested primer 2: | CCTGTACCACGTCCCTGACT |