Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.045245 |
Chromosome: | chromosome 7 |
Location: | 29043 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g312150 | (1 of 1) PF00580//PF13361 - UvrD/REP helicase N-terminal domain (UvrD-helicase) // UvrD-like helicase C-terminal domain (UvrD_C) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAATGTGCCCAGCGCCGCTAGTGACACTC |
Internal bar code: | CGAATTTCTGAACTCTTTAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 274 |
LEAP-Seq percent confirming: | 99.0385 |
LEAP-Seq n confirming: | 2266 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGCACCAAGCTAATGGT |
Suggested primer 2: | GCAAAGCTGCCTTGATTAGG |