| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.045245 |
| Chromosome: | chromosome 7 |
| Location: | 2868315 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332300 | GWD2,1 | Alpha-glucan water dikinase 2; (1 of 3) 2.7.9.4 - Alpha-glucan, water dikinase / Starch-related R1 protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGACAGGCCAAACCCTAGCAGACACCGGA |
| Internal bar code: | CTAATCTAGTTCGAACAAGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 87.1353 |
| LEAP-Seq n confirming: | 1971 |
| LEAP-Seq n nonconfirming: | 291 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGAGCAGGCAGGTTACG |
| Suggested primer 2: | GCCGTATGTCGAGCTAGGAG |