| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045260 |
| Chromosome: | chromosome 4 |
| Location: | 3056564 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225250 | (1 of 3) PF14494 - Domain of unknown function (DUF4436) (DUF4436) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTGGGTAGCGCTTGCCGCCGCCACCAC |
| Internal bar code: | ATGGGGGAGCGGATGCCTAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 84.2977 |
| LEAP-Seq n confirming: | 3205 |
| LEAP-Seq n nonconfirming: | 597 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATGTCCAAAACACACGC |
| Suggested primer 2: | GTGGACTCCAGAGTGGGTGT |