| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.045306 |
| Chromosome: | chromosome 17 |
| Location: | 2702651 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718000 | PHC7,PHC6 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 7 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACCCGCGCCCTTGAACACTCGCGCGCGA |
| Internal bar code: | CGTTCACCTTCTTTAGGGCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 99.3263 |
| LEAP-Seq n confirming: | 1327 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAAGCTCTTCCAGACGGT |
| Suggested primer 2: | CTCCTGGTAACCCCTCAACA |