| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.045354 |
| Chromosome: | chromosome 11 |
| Location: | 2037341 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468450 | CEN1,VFL2,DLE2 | 20 kD Calcium-Binding Protein Centrin (caltractin); (1 of 1) K16465 - centrin-1 (CETN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATGCCCACACCCACGCATGCAGATAAAG |
| Internal bar code: | CAGTAGGGTGAGTCAACGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 52.6316 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATTCGACCTGTAGGTGT |
| Suggested primer 2: | ACACCTGGTCAAAAGGATGC |