| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045354 |
| Chromosome: | chromosome_11 |
| Location: | 2037900 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre11.g468450 | cen1,VFL2 | Centrin present in monomeric inner arm dyneins b, e, and g | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GTACAAGATGGGACAGCCCGCGGAGGCGCC |
| Internal bar code: | GACCGTTGTCGGTGGAAAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 637 |
| LEAP-Seq percent confirming: | 98.142 |
| LEAP-Seq n confirming: | 1479 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACAGTGTACCCGGGCTGT |
| Suggested primer 2: | GTGTGGTTCCCTGTCGAAGT |