Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.045380 |
Chromosome: | chromosome 12 |
Location: | 2892276 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g502000 | FAP253 | Flagellar Associated Protein 253; (1 of 1) PTHR21074//PTHR21074:SF0 - UNCHARACTERIZED // IQ AND UBIQUITIN-LIKE DOMAIN-CONTAINING PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGACCTGACGCGTGAGCTGGTGGACCTC |
Internal bar code: | AAGGGGAAAGGCAAGTGGGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1013 |
LEAP-Seq percent confirming: | 99.3027 |
LEAP-Seq n confirming: | 11250 |
LEAP-Seq n nonconfirming: | 79 |
LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATCAACGCCAATCAGGAG |
Suggested primer 2: | GTTGGGTAACAGGCTGCATT |