| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.045485 |
| Chromosome: | chromosome 7 |
| Location: | 5574017 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351650 | BUG22,FAP20 | Transcription Factor 2-Like Flagellar Associated Protein 20; (1 of 3) PF05018 - Protein of unknown function (DUF667) (DUF667) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTCGCAGTTAGCAATGGCCACATCAAG |
| Internal bar code: | CCGCTTACCCGTCGATTACCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 719 |
| LEAP-Seq percent confirming: | 99.761 |
| LEAP-Seq n confirming: | 1252 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGATGTAGTTCGTCCCGT |
| Suggested primer 2: | CTAATAGCCGGCAAGCAAAG |