Insertion junction: LMJ.RY0402.045504_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.045504
Chromosome:chromosome_7
Location:1374254
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre07.g322550 FAP240 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCATAAGGCCAGGTGGGGAGGGGAGGGAG
Internal bar code:GGACCCTCGCCGGAGTGAAATA

Confirmation - LEAP-Seq

LEAP-Seq distance:743
LEAP-Seq percent confirming:99.205
LEAP-Seq n confirming:6364
LEAP-Seq n nonconfirming:51
LEAP-Seq n unique pos:54

Suggested primers for confirmation by PCR

Suggested primer 1:GGTAGCGTGAGGAATGGTGT
Suggested primer 2:CCGAGGCAAGTCAAGTTCTC