Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.045594 |
Chromosome: | chromosome_14 |
Location: | 2541683 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre14.g625500 | FAP254,ANK10 | Flagellar Associated Protein with ankyrin repeats | sense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | ATTCTTGTTCTTCTTTGGCATTGCACCCCC |
Internal bar code: | TCCGATTCCTTTTGGGAATCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 871 |
LEAP-Seq percent confirming: | 98.8158 |
LEAP-Seq n confirming: | 13101 |
LEAP-Seq n nonconfirming: | 157 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCTGACTTTTTCGGTCG |
Suggested primer 2: | ACGTCATAGGGCAGTGAACC |