| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.045615 |
| Chromosome: | chromosome 3 |
| Location: | 5365540 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184400 | (1 of 3) 3.6.1.22//3.6.1.55 - NAD(+) diphosphatase / NADP pyrophosphatase // 8-oxo-dGTP diphosphatase / 8-oxo-dGTPase; Putative NAD+ diphosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCGCCAAATGTTCACCCCATGATTCAA |
| Internal bar code: | CCCCCACCGACATGGGTACCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 73.9889 |
| LEAP-Seq n confirming: | 32800 |
| LEAP-Seq n nonconfirming: | 11531 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTGACTACGCTGGGTCAT |
| Suggested primer 2: | GGGGTTTCTGCGTTTTTGTA |