| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045634 |
| Chromosome: | chromosome 12 |
| Location: | 725062 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g495100 | PSR1 | (1 of 1) PF00249//PF14379 - Myb-like DNA-binding domain (Myb_DNA-binding) // MYB-CC type transfactor, LHEQLE motif (Myb_CC_LHEQLE); Phosphorus starvation response 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCAGTTAGGACGCCGTACGCCATAGAT |
| Internal bar code: | TTCGCGCGTCGCAGAAGGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 99.7813 |
| LEAP-Seq n confirming: | 2738 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTCCCATCACACACTTG |
| Suggested primer 2: | ATGCCCGTTTGCATAAAGTC |