| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.045664 |
| Chromosome: | chromosome 4 |
| Location: | 3212854 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226450 | PRP17 | (1 of 1) K12816 - pre-mRNA-processing factor 17 (CDC40, PRP17); Nuclear pre-mRNA splicing factor, component of the spliceosome | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTGGAACCAGGGGAGTGGCAAAGGCG |
| Internal bar code: | AGCGAGTTCAGAATCGGTGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 819 |
| LEAP-Seq percent confirming: | 99.2379 |
| LEAP-Seq n confirming: | 2344 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACTAGGAGGGTGAAAGG |
| Suggested primer 2: | TTTCTGTTTGGTCCCTGGAG |