| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.045714 |
| Chromosome: | chromosome 2 |
| Location: | 8526786 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141886 | (1 of 1) 2.7.10.2//2.7.11.1//2.7.11.17//2.7.11.18 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase // [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCATTCGATGTATCGGCACACATGCTTA |
| Internal bar code: | GGAAGGCCCGAGCTGCACCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 648 |
| LEAP-Seq percent confirming: | 99.4576 |
| LEAP-Seq n confirming: | 41441 |
| LEAP-Seq n nonconfirming: | 226 |
| LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTTTGTACCTTGCAGCCC |
| Suggested primer 2: | CAATGCGCGCTTACTTGTTA |