| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.045734 |
| Chromosome: | chromosome 16 |
| Location: | 1505227 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g653050 | (1 of 3) 2.1.1.200 - tRNA (cytidine(32)/uridine(32)-2'-O)-methyltransferase / TrMet(Xm32) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGTTTCGTGTGCGTACGGCAATCATTG |
| Internal bar code: | TACGACCAAAAACTTGCCTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 378 |
| LEAP-Seq percent confirming: | 64.0365 |
| LEAP-Seq n confirming: | 771 |
| LEAP-Seq n nonconfirming: | 433 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGTACACTGGGTTTGCT |
| Suggested primer 2: | GAGTTGCGCGTAAGAGTTCC |