Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.045780 |
Chromosome: | chromosome 11 |
Location: | 2984871 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g478300 | SOM4 | S-adenosyl-L-methionine-dependent O-methyltransferase; (1 of 4) PTHR13600//PTHR13600:SF12 - LEUCINE CARBOXYL METHYLTRANSFERASE // LEUCINE CARBOXYL METHYLTRANSFERASE | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGGGGTGGCGGTGGCGGTCGCGTGGGGA |
Internal bar code: | CAGCCGGTTATCGCAGTAGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 108 |
LEAP-Seq percent confirming: | 60.1458 |
LEAP-Seq n confirming: | 60897 |
LEAP-Seq n nonconfirming: | 40352 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
Suggested primer 2: | AGGTAGGAATGGGGGAAATG |