| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.045891 |
| Chromosome: | chromosome 5 |
| Location: | 992037 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g246753 | (1 of 2) IPR007204 - Actin-related protein 2/3 complex subunit 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTGAGGCAAGTGCCACAGCTCCACGA |
| Internal bar code: | ATTGAGGTGGCGTACCTAATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 99.6682 |
| LEAP-Seq n confirming: | 12016 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTTTCCTTCCGTTCTCC |
| Suggested primer 2: | TACTGTTGCGGGTGCTACTG |