| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.045937 |
| Chromosome: | chromosome 1 |
| Location: | 3583661 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023050 | UBX2 | (1 of 2) IPR006567//IPR018997 - PUG domain // PUB domain; Ubiquitin-associated protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGTATGGACGCACACACACGTGCGGCA |
| Internal bar code: | ATCTACTCGTAAACGCGTGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 131 |
| LEAP-Seq percent confirming: | 94.9231 |
| LEAP-Seq n confirming: | 3085 |
| LEAP-Seq n nonconfirming: | 165 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTGGTTTCTTGAGCTGTG |
| Suggested primer 2: | CAGTCCCAGTCCCAGTCCTA |