| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046103 |
| Chromosome: | chromosome 6 |
| Location: | 4071439 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278213 | LHCA6 | Light-harvesting protein of photosystem I; (1 of 2) K08910 - light-harvesting complex I chlorophyll a/b binding protein 4 (LHCA4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCACCACAAACACCACCCCGCCGCCGC |
| Internal bar code: | GCCGATTGCCGGCAAAAGAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 14.5541 |
| LEAP-Seq n confirming: | 519 |
| LEAP-Seq n nonconfirming: | 3047 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGACGCCTTGAAGCTTTT |
| Suggested primer 2: | GACCCCATCTTCAGCCAGTA |