| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046203 |
| Chromosome: | chromosome 10 |
| Location: | 912297 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424350 | (1 of 1) PTHR24209:SF7 - PROTEIN DA1-RELATED 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGATAAGCATAAGCACGCCACATCCACA |
| Internal bar code: | CGTGTGCGAGTAATTAGCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 278 |
| LEAP-Seq percent confirming: | 95.5036 |
| LEAP-Seq n confirming: | 1062 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTACTCCCTGCGTAACAT |
| Suggested primer 2: | CCCACTGTTCAGTGACCCA |