Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.046203 |
Chromosome: | chromosome 10 |
Location: | 912297 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g424350 | (1 of 1) PTHR24209:SF7 - PROTEIN DA1-RELATED 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGATAAGCATAAGCACGCCACATCCACA |
Internal bar code: | CGTGTGCGAGTAATTAGCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 278 |
LEAP-Seq percent confirming: | 95.5036 |
LEAP-Seq n confirming: | 1062 |
LEAP-Seq n nonconfirming: | 50 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTACTCCCTGCGTAACAT |
Suggested primer 2: | CCCACTGTTCAGTGACCCA |