| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.046210 |
| Chromosome: | chromosome 6 |
| Location: | 3469475 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278096 | SELU2,SELENOU,SELU1 | Selenoprotein U2; (1 of 4) PF13911 - AhpC/TSA antioxidant enzyme (AhpC-TSA_2) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAAACCCTGTCCTACTTCCTATCCACAGC |
| Internal bar code: | CGAACCCGGCGCCTGGCGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1034 |
| LEAP-Seq percent confirming: | 94.5098 |
| LEAP-Seq n confirming: | 241 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCGATCGATAAGGAAACC |
| Suggested primer 2: | GCACATACTGATCACCACGG |