| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.046316 |
| Chromosome: | chromosome 10 |
| Location: | 1337044 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427750 | KIN9C,KIN9-3 | Kinesin motor protein; (1 of 3) K10397 - kinesin family member 6/9 (KIF6_9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGGTAGCATGGTGGCGGCAGGAGGTGGA |
| Internal bar code: | ACTGGAAATCCTCGCGCGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 31.3861 |
| LEAP-Seq n confirming: | 317 |
| LEAP-Seq n nonconfirming: | 693 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTACCAATTGCGACCCAGT |
| Suggested primer 2: | TGTGTTATTGCGTATCGGGA |