| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.046358 |
| Chromosome: | chromosome 3 |
| Location: | 2710239 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g161400 | MAA7,WSN2 | (1 of 1) K01696 - tryptophan synthase beta chain (trpB); Tryptophan synthase beta subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGCAGAGCGAAGGGCCGCCTTGGTCGC |
| Internal bar code: | ATATTGAGAGTACTTTACAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 769 |
| LEAP-Seq percent confirming: | 99.1464 |
| LEAP-Seq n confirming: | 6272 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTACGGTATGGCAGTTCGG |
| Suggested primer 2: | GTTCCTCAAGGACGTGAAGC |