Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.046389 |
Chromosome: | chromosome 17 |
Location: | 713492 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701000 | (1 of 1) PTHR35518//PTHR35518:SF2 - FAMILY NOT NAMED // MAINTENANCE OF TELOMERE CAPPING PROTEIN 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACATACAGCCTGATGGCCGTGCTCATA |
Internal bar code: | GATGGTTGCCTGCCCCGCCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 520 |
LEAP-Seq percent confirming: | 99.4609 |
LEAP-Seq n confirming: | 369 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGAAAACGGTCTGCAAGC |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |