| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046393 |
| Chromosome: | chromosome 14 |
| Location: | 2193437 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g622700 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 5) PTHR11132//PTHR11132:SF101 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGGCGTGTCGGGGTGGCGGGTGGCAGC |
| Internal bar code: | GTGCTCACGGAAGAGAAGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 99.1991 |
| LEAP-Seq n confirming: | 867 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTGCAGCCTTTACCAGC |
| Suggested primer 2: | ATGCTGAAGCCCATAACTGG |