| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046443 |
| Chromosome: | chromosome 12 |
| Location: | 5495575 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530950 | TGL18 | (1 of 5) PF01734 - Patatin-like phospholipase (Patatin); Putative triacylglycerol lipase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATTCTTGCAACGCGCTTTGGGCGCAAT |
| Internal bar code: | CGATCCCTAGGAGGGCCGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 431 |
| LEAP-Seq percent confirming: | 97.7778 |
| LEAP-Seq n confirming: | 308 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACACACACCCACACACA |
| Suggested primer 2: | ACTAGGGTGCTGGGACATTG |