| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046469 |
| Chromosome: | chromosome 7 |
| Location: | 5929453 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354200 | GAP2 | Glyceraldehyde 3-phosphate dehydrogenase, GAPC, cytosolic; (1 of 2) 1.2.1.12 - Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) / Triosephosphate dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCACCATAACCTTACCTCTTCACACAC |
| Internal bar code: | GCCCGATGAGGTGGTTGATCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 384 |
| LEAP-Seq percent confirming: | 88.8981 |
| LEAP-Seq n confirming: | 3219 |
| LEAP-Seq n nonconfirming: | 402 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCAACTTTGCCAACTGA |
| Suggested primer 2: | TGTAGCCGTACTCGTTGTCG |