| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.046533 |
| Chromosome: | chromosome 3 |
| Location: | 7689508 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203730 | DEGO1,DEG12 | Inactive Deg protease; (1 of 4) PTHR22939//PTHR22939:SF83 - SERINE PROTEASE FAMILY S1C HTRA-RELATED // PROTEASE DO-LIKE 2, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAATCCGTCGCCGTACGCCGCCTTGTG |
| Internal bar code: | CCCTACTAAAACGAGCGACATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 434 |
| LEAP-Seq percent confirming: | 92.1927 |
| LEAP-Seq n confirming: | 555 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCGTTTGCCTTGTAGTTA |
| Suggested primer 2: | GCAGTAGGTTCTCCTCGTCG |