| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.046562 |
| Chromosome: | chromosome 7 |
| Location: | 5515357 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351050 | VPS23 | (1 of 1) K12183 - ESCRT-I complex subunit TSG101 (TSG101, STP22, VPS23); Subunit of the ESCRT-I complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTAAAACGCGTGCTGCCTGATAATGAA |
| Internal bar code: | GTAACATAACACGACGCTCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 454 |
| LEAP-Seq percent confirming: | 99.695 |
| LEAP-Seq n confirming: | 9151 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGTCGTACCCATGTCCT |
| Suggested primer 2: | CGTGTGTGCTGTTACCGACT |