Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.046612 |
Chromosome: | chromosome 6 |
Location: | 8171054 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g305251 | (1 of 1) IPR001680//IPR011045//IPR017986 - WD40 repeat // Nitrous oxide reductase, N-terminal // WD40-repeat-containing domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAACAATACAGAGACCTTGCTTTCTAT |
Internal bar code: | CCTGAAAGACGAGCTCGACTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 269 |
LEAP-Seq percent confirming: | 99.8227 |
LEAP-Seq n confirming: | 563 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCATGTACTTGTGTCTGG |
Suggested primer 2: | GCACGCAATCAAGAGATTCA |