| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.046630 |
| Chromosome: | chromosome 7 |
| Location: | 3280866 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334350 | (1 of 3) 2.7.1.39 - Homoserine kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCAACGCAACGCATCACCCACCTCGCGG |
| Internal bar code: | ATGCAGCATAGGTGTCACGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 306 |
| LEAP-Seq percent confirming: | 95.8877 |
| LEAP-Seq n confirming: | 133959 |
| LEAP-Seq n nonconfirming: | 5745 |
| LEAP-Seq n unique pos: | 147 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTTAAAGCAAACACCGCA |
| Suggested primer 2: | TTCGAGCTGTTCAAGGTGTG |