| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.046636 |
| Chromosome: | chromosome 3 |
| Location: | 8900950 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g208049 | (1 of 1) IPR000104//IPR000644//IPR007263 - Antifreeze protein, type I // CBS domain // Protein of unknown function DUF393 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCATAGCTGGCTGGCAAGCTGACATTT |
| Internal bar code: | GGTGATAGGGTCGGGCGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 755 |
| LEAP-Seq percent confirming: | 99.0999 |
| LEAP-Seq n confirming: | 1101 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCACACACACACACACAC |
| Suggested primer 2: | ACCATCCTACAACGAGACCG |