| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.046646 |
| Chromosome: | chromosome 13 |
| Location: | 887747 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567600 | COX4 | Mitochondrial cytochrome c oxidase subunit Vb, 13 kD; (1 of 1) PTHR10122 - CYTOCHROME C OXIDASE SUBUNIT 5B, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCAGGGGGCTGTCGGGCTGGTGGGTGCA |
| Internal bar code: | TCCCGGTAAGAGTTGCTTTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1062 |
| LEAP-Seq percent confirming: | 98.9331 |
| LEAP-Seq n confirming: | 13353 |
| LEAP-Seq n nonconfirming: | 144 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATACAAGCCACACAGGGA |
| Suggested primer 2: | ACGCTACTGGTGAAGCGACT |