| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.046663 |
| Chromosome: | chromosome 3 |
| Location: | 7247836 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g207550 | ADH8,CAD2 | Cinnamyl-alcohol dehydrogenase; (1 of 2) 1.1.1.195 - Cinnamyl-alcohol dehydrogenase / CAD | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCAGGTGAGAGGCAGTACGGGCAACAT |
| Internal bar code: | AGCCAATAGGAGGCTCGAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 95.2263 |
| LEAP-Seq n confirming: | 1157 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGGAGAGGGTACGGTAT |
| Suggested primer 2: | GCGTCTAGCGATGTAGAGGG |