Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.046786 |
Chromosome: | chromosome 6 |
Location: | 2585831 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269450 | EIF3G | Eukaryotic translation initiation factor 3, subunit G; (1 of 1) K03248 - translation initiation factor 3 subunit G (EIF3G) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGTGACTGCGCAGGACCGCTCCGCTGG |
Internal bar code: | TGGGACTCATGTTTAACTACTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 765 |
LEAP-Seq percent confirming: | 99.9179 |
LEAP-Seq n confirming: | 2435 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGATGGTGTTGACAGGGGAG |
Suggested primer 2: | CCCAGTTTACTGCGTGTCAA |