Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.046818 |
Chromosome: | scaffold 36 |
Location: | 6120 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre36.g759597 | (1 of 2) IPR001841//IPR013083//IPR024766 - Zinc finger, RING-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, RING-H2-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCACCAACCGCCATGTGCCCAGATATA |
Internal bar code: | GCGTCGGAAACAGATTGAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 482 |
LEAP-Seq percent confirming: | 99.359 |
LEAP-Seq n confirming: | 1395 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACATGATGACGGCTTTCC |
Suggested primer 2: | AGCTGTGTGTGAGGCAGATG |