| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.046826 |
| Chromosome: | chromosome 14 |
| Location: | 3936064 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633000 | ERV1,TOX1,ERV1A | Essential for Respiration and Viability 1; (1 of 2) K17783 - mitochondrial FAD-linked sulfhydryl oxidase [EC:1.8.3.2] (ERV1, GFER, ALR) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATGAAAGAATGATAGAATGAGCAGAGC |
| Internal bar code: | TCCGCGCCGTGTGACCATGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 99.6523 |
| LEAP-Seq n confirming: | 3439 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTGGAACCCTGAGGTTA |
| Suggested primer 2: | CTGTTCCCACTGTTCCCACT |