| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.047063 |
| Chromosome: | chromosome 16 |
| Location: | 1318634 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g651700 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAATGGCTATCTACGCCTGTGTTTGCA |
| Internal bar code: | ATTCCCGGATTGCGTCGCTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 98.7032 |
| LEAP-Seq n confirming: | 685 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACGAAGCAAGAAAGGAAG |
| Suggested primer 2: | CTTCTTGTAGCCTCGCAACC |