| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.047091 |
| Chromosome: | chromosome 1 |
| Location: | 6317602 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g045000 | PRL9 | Predicted extracellular protein; (1 of 2) IPR001283//IPR002413//IPR014044 - Cysteine-rich secretory protein, allergen V5/Tpx-1-related // Ves allergen // CAP domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACTCTTCCGTTACCTTGTCCTACCCCA |
| Internal bar code: | GTCATACGCGACGGCTGCCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 99.6979 |
| LEAP-Seq n confirming: | 990 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACATCCACAACATCAGC |
| Suggested primer 2: | CATCAGCTAGCAGCATCTCG |