| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.047109 |
| Chromosome: | chromosome 9 |
| Location: | 4382765 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395288 | NHA1 | (1 of 1) PTHR10283:SF103 - GENOMIC DNA, CHROMOSOME 3, P1 CLONE: MLD14-RELATED; Sodium ion/proton transporter protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAATGTAACCCACCAACCCCTCATCAAG |
| Internal bar code: | AGTTGTTCAAAGAGATGTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 795 |
| LEAP-Seq percent confirming: | 27.8241 |
| LEAP-Seq n confirming: | 1101 |
| LEAP-Seq n nonconfirming: | 2856 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGTAATGGTGCTCACTCC |
| Suggested primer 2: | TCCCACCACCTCACACTACA |