Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.047149 |
Chromosome: | chromosome 8 |
Location: | 4860822 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g384750 | AMYA3,AMA3 | Alpha-amylase 3; (1 of 3) K01176 - alpha-amylase (E3.2.1.1, amyA, malS) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCAAACGTCAGTGTGCCCCACTCTAT |
Internal bar code: | ATCAATGATTTTCAGCGGCGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 78 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCGTCTGCTGGTCTTCAA |
Suggested primer 2: | TGTGTTGTTGGAGACGAAGC |