| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.047175 |
| Chromosome: | chromosome 12 |
| Location: | 9534447 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544752 | (1 of 26) IPR013026//IPR019734 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAATGTGCACGCTAAGCCCCTTCCACAAC |
| Internal bar code: | AACTTGCGTTGATGCGGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 945 |
| LEAP-Seq percent confirming: | 68.3887 |
| LEAP-Seq n confirming: | 5335 |
| LEAP-Seq n nonconfirming: | 2466 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGAGCTGCCACTGAACAT |
| Suggested primer 2: | GACGGGTTGACTGGTTGAGT |