| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.047216 |
| Chromosome: | chromosome 7 |
| Location: | 1033901 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319550 | (1 of 1) PF10442 - FIST C domain (FIST_C) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAAGAACGGAGGCCAAGACTCTCGCTG |
| Internal bar code: | GTGTCTTGTCGGACTCATCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 940 |
| LEAP-Seq percent confirming: | 99.5192 |
| LEAP-Seq n confirming: | 207 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATTAGGAGGACCAAACA |
| Suggested primer 2: | AGCTTGCTGAGAGGTGTCGT |