Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.047229 |
Chromosome: | chromosome 6 |
Location: | 7281200 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298550 | FMO7 | Flavin-containing monooxygenase; (1 of 3) K00485 - dimethylaniline monooxygenase (N-oxide forming) (FMO) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTACAGACGTCGATCCATTGTCTGTGCA |
Internal bar code: | GACATGCACAGTTCGTATTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 670 |
LEAP-Seq percent confirming: | 98.8662 |
LEAP-Seq n confirming: | 436 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACAAGGCGAATACAGTCA |
Suggested primer 2: | GACCTGGGACAAGTACGGAA |